I had to browse my dictionary to get all my gene's taxon and everytime I encounter a taxon, I open the .fasta
file with the same name and in this fasta file I had to look for the geneID I encountered during the taxon research. This is possible because in the file with which I made my dictionary has "taxon1|geneID1, taxon1|geneID2, taxon2|geneID1,...". And so, when I meet the specific geneID in the specific fasta file, I had to stock all the lines under the specific geneID to be able to write it in a new file. The fasta file looks like:
>taxon|gene1
ACTGCATCGCTAGCTAGAAATCGCTA
TACGATCAAACCTAGCGATCTTACGA
>taxon|gene2
TAGCTAGCTAGCTAGAATATCCCGAT
GCTAGCAATGCTCTTCCGGTAGCTAT
So when i meet the right geneID in the fasta file, the lines i have to copy/stock are the following 2 lines with all the ATGC. I did a few functions to make everything I said, but i'm stuck and the write part of the file from datas that i stocked. Here is a part of my code :
def readFastaFile(taxonomy, searchGeneId):
fastaFile = open(taxonomy + ".fasta", "r")
banco = False
geneIdSequence = ""
for line in fastaFile:
if line[0] == ">":
elements = line.split("|")
taxonomy = elements[0]
geneID = elements[1]
if geneID == searchGeneId:
banco = True
else:
banco = False
else:
if banco == True:
geneIdSequence += line
fastaFile.close()
return geneIdSequence
def getSequencesFromFastasAndWriteThemInNewFastas(dictio):
for groupName in dictio:
taxonAndGene = dictio[groupName]
groupFastaFile = open(groupName + ".fasta", "w")
for taxon in taxonAndGene:
geneIDs = taxonAndGene[taxon]
#print("search" + str(geneIDs) + " in " + taxon + ".fasta")
for geneId in geneIDS:
readFastaFile(taxon, geneId)
groupFastaFile.write() #HERE is the part where i'm stuck
groupFastaFile.write("\n")
groupFastaFile.close()
My problem is in the lasts lines (marked by the #HERE comment):
I don't know what to write between the ()
to write the data from the fasta files into my new file.
Thank you for your answers.
Anyway, I found a solution to my problem.
I added lines :
in my function :
to remove the "\n" at the end of the geneIDs and then i added lines :
in my function :
So it works perfectly as expected. I'm sorry if my post took you some time yo read. Have a great day.